Stem-loop sequence cpo-mir-183

AccessionMI0038671 (change log)
DescriptionCavia porcellus miR-183 stem-loop
Stem-loop
   --      --ac     ga        --   ac 
5'   uauggc    uggua  auucacug  uga  a
     ||||||    |||||  ||||||||  |||   
3'   auaccg    gccau  uaagugac  acu  g
   aa      ggaa     --        ug   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 50142394-50142455 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-183
cpo-mir-183DS562866.1: 50142394-50142455 [-]
cpo-mir-96DS562866.1: 50142184-50142247 [-]
cpo-mir-182DS562866.1: 50138735-50138799 [-]
Database links

Mature sequence cpo-miR-183-5p

Accession MIMAT0047050
Sequence

1 - 

uauggcacugguagaauucacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-183-3p

Accession MIMAT0047051
Sequence

41 - 

ugaauuaccgaagggccauaaa

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).