Stem-loop sequence cpo-mir-182

AccessionMI0038670 (change log)
DescriptionCavia porcellus miR-182 stem-loop
Stem-loop
   --u       u -g      uca      ugaggu 
5'    uuggcaa g  uagaac   cacugg      a
      ||||||| |  ||||||   ||||||       
3'    aaccguu c  aucuug   guggcc      a
   auc       - ag      ---      uagggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 50138735-50138799 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-182
cpo-mir-183DS562866.1: 50142394-50142455 [-]
cpo-mir-96DS562866.1: 50142184-50142247 [-]
cpo-mir-182DS562866.1: 50138735-50138799 [-]
Database links

Mature sequence cpo-miR-182-5p

Accession MIMAT0047048
Sequence

1 - 

uuuggcaaugguagaacucacacu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-182-3p

Accession MIMAT0047049
Sequence

45 - 

ugguucuagacuugccaacua

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).