Stem-loop sequence cpo-mir-181c

AccessionMI0038669 (change log)
DescriptionCavia porcellus miR-181c stem-loop
Stem-loop
   --aa        cu       a     ga ga 
5'     cauucaac  gucggug guuug  c  c
       ||||||||  ||||||| |||||  |   
3'     gugaguug  cagcuac caaac  g  u
   ccag        -c       -     -g ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562897.1: 12912419-12912479 [-]
intergenic
Database links

Mature sequence cpo-miR-181c-5p

Accession MIMAT0047046
Sequence

1 - 

aacauucaaccugucggugaguuu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-181c-3p

Accession MIMAT0047047
Sequence

40 - 

accaucgaccguugaguggacc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).