Stem-loop sequence cpo-mir-181b-1

AccessionMI0038667 (change log)
DescriptionCavia porcellus miR-181b-1 stem-loop
Stem-loop
   -aa         cug         ugaa    g 
5'    cauucauug   ucggugggu    uugu u
      |||||||||   |||||||||    ||||  
3'    guaaguaac   ggucacucg    aaca g
   aac         --a         ----    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 23445282-23445342 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-181b-1
cpo-mir-181a-1DS562867.1: 23445099-23445160 [+]
cpo-mir-181b-1DS562867.1: 23445282-23445342 [+]
Database links

Mature sequence cpo-miR-181b-5p

Accession MIMAT0047043
Sequence

1 - 

aacauucauugcugucgguggguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-181b-3p

Accession MIMAT0047044
Sequence

41 - 

cucacuggacaaugaaugcaa

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).