Stem-loop sequence cpo-mir-155

AccessionMI0038664 (change log)
DescriptionCavia porcellus miR-155 stem-loop
Stem-loop
   --          u    a        -u   c 
5'   uuaaugcuaa cgug uagggguu  uua c
     |||||||||| |||| ||||||||  |||  
3'   aauuacgauu guac auccucag  agu u
   ac          -    -        uc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562907.1: 7888282-7888342 [-]
intergenic
Database links

Mature sequence cpo-miR-155-5p

Accession MIMAT0047038
Sequence

1 - 

uuaaugcuaaucgugauagggguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-155-3p

Accession MIMAT0047039
Sequence

40 - 

cuccuacauguuagcauuaaca

 - 61

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).