Stem-loop sequence cpo-mir-153

AccessionMI0038662 (change log)
DescriptionCavia porcellus miR-153 stem-loop
Stem-loop
   --              gu       -a  aa 
5'   gucauuuuugugau  ugcagcu  gu  u
     ||||||||||||||  |||||||  ||  a
3'   uagugaaaacacug  acguuga  cg  u
   ac              au       cc  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 5180975-5181036 [-]
intergenic
Database links

Mature sequence cpo-miR-153-5p

Accession MIMAT0047034
Sequence

1 - 

gucauuuuugugauguugcagcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-153-3p

Accession MIMAT0047035
Sequence

40 - 

uugcauagucacaaaagugauc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).