Stem-loop sequence cpo-mir-152

AccessionMI0038661 (change log)
DescriptionCavia porcellus miR-152 stem-loop
Stem-loop
   --         g  a    ca    - ggac 
5'   agguucugu au cacu  gacu c    u
     ||||||||| || ||||  |||| |     
3'   uucaagaca ua guga  cuga g    c
   gg         g  c    --    c aggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562908.1: 9067372-9067430 [+]
intergenic
Database links

Mature sequence cpo-miR-152-5p

Accession MIMAT0047032
Sequence

1 - 

agguucugugauacacucagacu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-152-3p

Accession MIMAT0047033
Sequence

39 - 

ucagugcaugacagaacuugg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).