Stem-loop sequence cpo-mir-151

AccessionMI0038660 (change log)
DescriptionCavia porcellus miR-151 stem-loop
Stem-loop
   --          ca          u uc 
5'   ucgaggagcu  cagucuagua g  u
     ||||||||||  |||||||||| |  c
3'   aguuccucgg  gucagaucau c  u
   gg          -a          c ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562872.1: 36727980-36728035 [+]
intergenic
Database links

Mature sequence cpo-miR-151-5p

Accession MIMAT0047030
Sequence

1 - 

ucgaggagcucacagucuagua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-151-3p

Accession MIMAT0047031
Sequence

36 - 

cuagacugaggcuccuugagg

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).