Stem-loop sequence cpo-mir-150

AccessionMI0038659 (change log)
DescriptionCavia porcellus miR-150 stem-loop
Stem-loop
   --       ac   u         -   u 
5'   ucuccca  ccu guaccagug cug g
     |||||||  ||| ||||||||| ||| c
3'   ggggggu  gga cauggucgc gac c
   ac       cc   -         a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562925.1: 8005631-8005687 [+]
intergenic
Database links

Mature sequence cpo-miR-150-5p

Accession MIMAT0047028
Sequence

1 - 

ucucccaacccuuguaccagug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-150-3p

Accession MIMAT0047029
Sequence

37 - 

cugguacaggccuggggggca

 - 57

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).