Stem-loop sequence cpo-mir-148b

AccessionMI0038657 (change log)
DescriptionCavia porcellus miR-148b stem-loop
Stem-loop
   --          u  a    ca    gugg u 
5'   gaaguucugu au cacu  ggcu    c c
     |||||||||| || ||||  ||||    | u
3'   uuucaagaca ua guga  cuga    g c
   ug          c  c    --    --aa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562864.1: 45498342-45498402 [-]
intergenic
Database links

Mature sequence cpo-miR-148b-5p

Accession MIMAT0047024
Sequence

1 - 

gaaguucuguuauacacucaggcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-148b-3p

Accession MIMAT0047025
Sequence

40 - 

ucagugcaucacagaacuuugu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).