Stem-loop sequence cpo-mir-148a

AccessionMI0038656 (change log)
DescriptionCavia porcellus miR-148a stem-loop
Stem-loop
   --         -  -a    cc    -   ag 
5'   aaaguucug ag  cacu  gacu cug  u
     ||||||||| ||  ||||  |||| |||  a
3'   uuucaagac uc  guga  cuga gau  u
   ug         a  ac    --    a   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562899.1: 2858896-2858955 [-]
intergenic
Database links

Mature sequence cpo-miR-148a-5p

Accession MIMAT0047022
Sequence

1 - 

aaaguucugagacacuccgacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-148a-3p

Accession MIMAT0047023
Sequence

39 - 

ucagugcacuacagaacuuugu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).