Stem-loop sequence cpo-mir-147

AccessionMI0038655 (change log)
DescriptionCavia porcellus miR-147 stem-loop
Stem-loop
   --     a        g   ggc    -  c 
5'   cggaa cacuuccg aca   uugg gu u
     ||||| |||||||| |||   |||| ||  
3'   gucuu gugaaggc ugu   gacc ca g
   uc     c        g   ---    a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562878.1: 20636312-20636369 [+]
intergenic
Database links

Mature sequence cpo-miR-147-5p

Accession MIMAT0047020
Sequence

1 - 

cggaaacacuuccggacaggc

 - 21

Get sequence
Evidence not experimental

Mature sequence cpo-miR-147-3p

Accession MIMAT0047021
Sequence

38 - 

gugugcggaagugcuucugcu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).