Stem-loop sequence cpo-mir-146b

AccessionMI0038654 (change log)
DescriptionCavia porcellus miR-146b stem-loop
Stem-loop
   -ua        a    gu    u  ga  u 
5'    agaacuga uucu  aggc gu  gc c
      |||||||| ||||  |||| ||  ||  
3'    ucuugacu aggg  uccg ua  cg c
   agg        c    au    -  aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 12137383-12137442 [-]
intergenic
Database links

Mature sequence cpo-miR-146b-5p

Accession MIMAT0047018
Sequence

1 - 

uaagaacugaauucuguaggcug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-146b-3p

Accession MIMAT0047019
Sequence

39 - 

gccuuagggacucaguucugga

 - 60

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).