Stem-loop sequence cpo-mir-145

AccessionMI0038652 (change log)
DescriptionCavia porcellus miR-145 stem-loop
Literature search

2 open access papers mention cpo-mir-145
(3 sentences)

Stem-loop
   -- uc    u  c            uggau 
5'   g  cagu uu ccaggaaucccu     g
     |  |||| || ||||||||||||     c
3'   c  guca aa gguccuuagggg     u
   uu uu    u  a            uagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 11377829-11377889 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-145
cpo-mir-143DS562861.1: 11376289-11376343 [+]
cpo-mir-145DS562861.1: 11377829-11377889 [+]
Database links

Mature sequence cpo-miR-145-5p

Accession MIMAT0047014
Sequence

1 - 

guccaguuuucccaggaaucccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-145-3p

Accession MIMAT0047015
Sequence

39 - 

ggauuccuggaaauacuguucuu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).