Stem-loop sequence cpo-mir-144

AccessionMI0038651 (change log)
DescriptionCavia porcellus miR-144 stem-loop
Stem-loop
   -  -        a         -a    gu 
5'  gg auaucauc uauacugua  guuu  g
    || |||||||| |||||||||  ||||   
3'  uc uguaguag auaugacau  caga  a
   a  a        -         ca    gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 23622352-23622409 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-144
cpo-mir-144DS562887.1: 23622352-23622409 [+]
cpo-mir-451DS562887.1: 23622505-23622561 [+]
Database links

Mature sequence cpo-miR-144-5p

Accession MIMAT0047012
Sequence

1 - 

ggauaucaucauauacuguaagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-144-3p

Accession MIMAT0047013
Sequence

38 - 

uacaguauagaugauguacua

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).