Stem-loop sequence cpo-mir-143

AccessionMI0038650 (change log)
DescriptionCavia porcellus miR-143 stem-loop
Stem-loop
   -- g         g      u  -  ag 
5'   g ugcagugcu caucuc gg uc  u
     | ||||||||| |||||| || ||   
3'   c augucacga guagag cu ag  u
   cu g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562861.1: 11376289-11376343 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-143
cpo-mir-143DS562861.1: 11376289-11376343 [+]
cpo-mir-145DS562861.1: 11377829-11377889 [+]
Database links

Mature sequence cpo-miR-143-5p

Accession MIMAT0047010
Sequence

1 - 

ggugcagugcugcaucucugg

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-143-3p

Accession MIMAT0047011
Sequence

35 - 

ugagaugaagcacuguagcuc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).