Stem-loop sequence cpo-mir-142

AccessionMI0038649 (change log)
DescriptionCavia porcellus miR-142 stem-loop
Stem-loop
   --          a         uaa ag a 
5'   cauaaaguag aagcacuac   c  c c
     |||||||||| |||||||||   |  |  
3'   guauuucauc uuugugaug   g  g u
   ag          c         -ug ga g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562908.1: 558172-558230 [+]
intergenic
Database links

Mature sequence cpo-miR-142-5p

Accession MIMAT0047008
Sequence

1 - 

cauaaaguagaaagcacuacu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-142-3p

Accession MIMAT0047009
Sequence

39 - 

uaguguuuccuacuuuaugga

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).