Stem-loop sequence cpo-mir-141

AccessionMI0038648 (change log)
DescriptionCavia porcellus miR-141 stem-loop
Stem-loop
   --      --    c          uu -g  ua 
5'   caucuu  ccag acaguguugg  g  uc  a
     ||||||  |||| ||||||||||  |  ||  u
3'   guagaa  gguc ugucacaauc  c  ag  u
   cg      au    -          cu ga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562962.1: 310108-310172 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-141
cpo-mir-200cDS562962.1: 310456-310518 [-]
cpo-mir-141DS562962.1: 310108-310172 [-]
Database links

Mature sequence cpo-miR-141-5p

Accession MIMAT0047006
Sequence

1 - 

caucuuccagcacaguguuggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-141-3p

Accession MIMAT0047007
Sequence

43 - 

uaacacugucugguaaagauggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).