Stem-loop sequence cpo-mir-140

AccessionMI0038647 (change log)
DescriptionCavia porcellus miR-140 stem-loop
Stem-loop
   --ca             a       uu   uc 
5'     gugguuuuacccu ugguagg  acg  a
       ||||||||||||| |||||||  |||   
3'     caccaagauggga accaucu  ugu  u
   cagg             c       --   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562877.1: 6810958-6811019 [-]
intergenic
Database links

Mature sequence cpo-miR-140-5p

Accession MIMAT0047004
Sequence

1 - 

cagugguuuuacccuaugguag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-140-3p

Accession MIMAT0047005
Sequence

41 - 

accacaggguagaaccacggac

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).