Stem-loop sequence cpo-mir-139

AccessionMI0038646 (change log)
DescriptionCavia porcellus miR-139 stem-loop
Stem-loop
   gug       -   u  a            g gg 
5'    uauucua cag gc cgugucuccagc u  c
      ||||||| ||| || |||||||||||| |  u
3'    augaggu guc cg gcgcagaggucg a  c
   -ca       u   c  -            g gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562958.1: 2790717-2790784 [+]
intergenic
Database links

Mature sequence cpo-miR-139-5p

Accession MIMAT0047002
Sequence

7 - 

ucuacagugcacgugucuccagc

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-139-3p

Accession MIMAT0047003
Sequence

43 - 

uggagacgcggcccuguuggagu

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).