Stem-loop sequence cpo-mir-138-2

AccessionMI0038645 (change log)
DescriptionCavia porcellus miR-138-2 stem-loop
Stem-loop
   -ag             uca     -ac   c  cg 
5'    cugguguugugaa   ggccg   gag ag  c
      |||||||||||||   |||||   ||| ||   
3'    gaccacagcacuu   ucggc   uuc uc  a
   ugg             -ua     cca   -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562877.1: 25185275-25185342 [-]
intergenic
Database links

Mature sequence cpo-miR-138-5p

Accession MIMAT0046999
Sequence

1 - 

agcugguguugugaaucaggccg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-138-2-3p

Accession MIMAT0047001
Sequence

48 - 

gcuauuucacgacaccagggu

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).