Stem-loop sequence cpo-mir-136

AccessionMI0038643 (change log)
DescriptionCavia porcellus miR-136 stem-loop
Stem-loop
   --    c     uuu          uuc 
5'   acuc auuug   ugaugaugga   u
     |||| |||||   ||||||||||   u
3'   ugag uaaac   gcuacuaccu   a
   uc    -     ucu          cgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 955349-955404 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-136
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-136-5p

Accession MIMAT0046997
Sequence

1 - 

acuccauuuguuuugaugaugga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-136-3p

Accession MIMAT0046998
Sequence

35 - 

caucaucgucucaaaugagucu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).