Stem-loop sequence cpo-mir-135b

AccessionMI0038642 (change log)
DescriptionCavia porcellus miR-135b stem-loop
Stem-loop
   --          cau          --   cu 
5'   uauggcuuuu   uccuauguga  uug  g
     ||||||||||   ||||||||||  |||   
3'   guaccgaaaa   gggauguacu  aac  u
   gg          -uc          ua   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 17315920-17315980 [+]
intergenic
Database links

Mature sequence cpo-miR-135b-5p

Accession MIMAT0046995
Sequence

1 - 

uauggcuuuucauuccuauguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-135b-3p

Accession MIMAT0046996
Sequence

40 - 

auguagggcuaaaagccauggg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).