Stem-loop sequence cpo-mir-134

AccessionMI0038639 (change log)
DescriptionCavia porcellus miR-134 stem-loop
Stem-loop
   --u        u  -a   g    ---    g 
5'    gugacugg ug  cca aggg   gcau c
      |||||||| ||  ||| ||||   |||| a
3'    cacugauc ac  ggu uccc   ugug c
   aac        c  cg   g    acu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 1107399-1107459 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-134
cpo-mir-1185DS562966.1: 1097764-1097823 [+]
cpo-mir-381DS562966.1: 1099199-1099261 [+]
cpo-mir-487bDS562966.1: 1099737-1099794 [+]
cpo-mir-539DS562966.1: 1100599-1100662 [+]
cpo-mir-889DS562966.1: 1101145-1101203 [+]
cpo-mir-655DS562966.1: 1102750-1102809 [+]
cpo-mir-3959DS562966.1: 1104334-1104387 [+]
cpo-mir-487aDS562966.1: 1104622-1104679 [+]
cpo-mir-382DS562966.1: 1107038-1107096 [+]
cpo-mir-134DS562966.1: 1107399-1107459 [+]
cpo-mir-485DS562966.1: 1108140-1108198 [+]
cpo-mir-154DS562966.1: 1112305-1112362 [+]
cpo-mir-496DS562966.1: 1113040-1113093 [+]
cpo-mir-377DS562966.1: 1114436-1114495 [+]
cpo-mir-541DS562966.1: 1116256-1116321 [+]
cpo-mir-409DS562966.1: 1117072-1117125 [+]
cpo-mir-412DS562966.1: 1117221-1117276 [+]
cpo-mir-369DS562966.1: 1117336-1117391 [+]
Database links

Mature sequence cpo-miR-134-5p

Accession MIMAT0046990
Sequence

1 - 

ugugacugguugaccagagggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-134-3p

Accession MIMAT0046991
Sequence

40 - 

cugugggccaccuagucaccaa

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).