Stem-loop sequence cpo-mir-132

AccessionMI0038635 (change log)
DescriptionCavia porcellus miR-132 stem-loop
Stem-loop
   --         uuc          -g     
5'   accguggcu   gauuguuacu  uggg 
     |||||||||   ||||||||||  ||| a
3'   ugguaccga   cugacaaugg  gcca 
   gc         cau          ag     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562887.1: 20419190-20419247 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-132
cpo-mir-212DS562887.1: 20418791-20418852 [+]
cpo-mir-132DS562887.1: 20419190-20419247 [+]
Database links

Mature sequence cpo-miR-132-5p

Accession MIMAT0046984
Sequence

1 - 

accguggcuuucgauuguuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-132-3p

Accession MIMAT0046985
Sequence

37 - 

uaacagucuacagccauggucg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).