Stem-loop sequence cpo-mir-130a

AccessionMI0038633 (change log)
DescriptionCavia porcellus miR-130a stem-loop
Stem-loop
   --        c      ug  a  gucu  a 
5'   gcucuuuu acauug  cu cu    gc c
     |||||||| ||||||  || ||    ||  
3'   cgggaaaa uguaac  ga ga    ug u
   ua        u      gu  c  acac  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562941.1: 2921906-2921967 [-]
intergenic
Database links

Mature sequence cpo-miR-130a-5p

Accession MIMAT0046980
Sequence

1 - 

gcucuuuucacauugugcuacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-130a-3p

Accession MIMAT0046981
Sequence

41 - 

cagugcaauguuaaaagggcau

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).