Stem-loop sequence cpo-mir-129-2

AccessionMI0038632 (change log)
DescriptionCavia porcellus miR-129-2 stem-loop
Stem-loop
   ---       c   cu      ---     aca 
5'    cuuuuug ggu  gggcuu   gcugu   u
      ||||||| |||  ||||||   |||||   u
3'    gaaaaac cca  cccgaa   cgaua   a
   uac       c   uu      ggc     cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562927.1: 3626366-3626428 [+]
intergenic
Database links

Mature sequence cpo-miR-129-5p

Accession MIMAT0046977
Sequence

1 - 

cuuuuugcggucugggcuugc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-129-2-3p

Accession MIMAT0046979
Sequence

42 - 

aagcccuuaccccaaaaagcau

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).