Stem-loop sequence cpo-mir-127

AccessionMI0038628 (change log)
DescriptionCavia porcellus miR-127 stem-loop
Stem-loop
   -cug         g  c      --  a 
5'     aagcucaga gg ucugau  uc g
       ||||||||| || ||||||  || a
3'     uucgagucu cc aggcua  ag a
   ucgg         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562966.1: 953628-953683 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-127
cpo-mir-337DS562966.1: 946840-946900 [+]
cpo-mir-431DS562966.1: 951653-951716 [+]
cpo-mir-12073DS562966.1: 952329-952402 [+]
cpo-mir-433DS562966.1: 952524-952597 [+]
cpo-mir-127DS562966.1: 953628-953683 [+]
cpo-mir-432DS562966.1: 955129-955197 [+]
cpo-mir-136DS562966.1: 955349-955404 [+]
Database links

Mature sequence cpo-miR-127-5p

Accession MIMAT0046972
Sequence

1 - 

cugaagcucagagggcucugauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-127-3p

Accession MIMAT0046973
Sequence

35 - 

ucggauccgucugagcuuggcu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).