Stem-loop sequence cpo-mir-126

AccessionMI0038627 (change log)
DescriptionCavia porcellus miR-126 stem-loop
Stem-loop
   --           u       c cug   c 
5'   cauuauuacuu ugguacg g   uga a
     ||||||||||| ||||||| |   |||  
3'   guaauaaugag gccaugc c   acu c
   gc           u       u -aa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562873.1: 39180092-39180150 [+]
intergenic
Database links

Mature sequence cpo-miR-126-5p

Accession MIMAT0046970
Sequence

1 - 

cauuauuacuuuugguacgcgc

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-126-3p

Accession MIMAT0046971
Sequence

38 - 

ucguaccgugaguaauaaugcg

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).