Stem-loop sequence cpo-mir-125b-1

AccessionMI0038625 (change log)
DescriptionCavia porcellus miR-125b-1 stem-loop
Stem-loop
   --uc  ug   c           au     c 
5'     cc  aga ccuaacuugug  guuua c
       ||  ||| |||||||||||  ||||| g
3'     gg  ucu ggauugggcac  uaaau u
   ucga  gu   c           -c     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562874.1: 26176071-26176132 [+]
intergenic
Database links

Mature sequence cpo-miR-125b-5p

Accession MIMAT0046967
Sequence

1 - 

ucccugagacccuaacuuguga

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-125b-3p

Accession MIMAT0046968
Sequence

41 - 

acggguuaggcucuugggagcu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).