Stem-loop sequence cpo-mir-125a

AccessionMI0038624 (change log)
DescriptionCavia porcellus miR-125a stem-loop
Stem-loop
   --uc  ug   c    ua        ----  a 
5'     cc  aga ccuu  accuguga    gg c
       ||  ||| ||||  ||||||||    ||  
3'     gg  ucu ggag  uggacacu    cc a
   ccga  gu   u    --        ggga  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562925.1: 6339828-6339887 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-125a
cpo-mir-99bDS562925.1: 6340368-6340427 [-]
cpo-let-7eDS562925.1: 6340207-6340273 [-]
cpo-mir-125aDS562925.1: 6339828-6339887 [-]
Database links

Mature sequence cpo-miR-125a-5p

Accession MIMAT0046965
Sequence

1 - 

ucccugagacccuuuaaccuguga

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-125a-3p

Accession MIMAT0046966
Sequence

39 - 

acaggugagguucuugggagcc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).