Stem-loop sequence cpo-mir-122

AccessionMI0038621 (change log)
DescriptionCavia porcellus miR-122 stem-loop
Stem-loop
   --ugg       c           --u  c 
5'      aguguga aaugguguuug   gu c
        ||||||| |||||||||||   ||  
3'      ucacacu uuaccgcaaac   ca a
   auaaa       a           uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562869.1: 7085943-7086000 [-]
intergenic
Database links

Mature sequence cpo-miR-122-5p

Accession MIMAT0046961
Sequence

1 - 

uggagugugacaaugguguuug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-122-3p

Accession MIMAT0046962
Sequence

37 - 

aacgccauuaucacacuaaaua

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).