Stem-loop sequence cpo-mir-106b

AccessionMI0038619 (change log)
DescriptionCavia porcellus miR-106b stem-loop
Stem-loop
   --ua       g       agaua    uc u 
5'     aagugcu acagugc     gugg  c c
       ||||||| |||||||     ||||  | u
3'     uucaugg ugucacg     cauc  g c
   gucg       g       ----c    gu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562885.1: 4035937-4035997 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-106b
cpo-mir-106bDS562885.1: 4035937-4035997 [+]
cpo-mir-93DS562885.1: 4036154-4036215 [+]
cpo-mir-25DS562885.1: 4036356-4036415 [+]
Database links

Mature sequence cpo-miR-106b-5p

Accession MIMAT0046957
Sequence

1 - 

uaaagugcugacagugcagaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-106b-3p

Accession MIMAT0046958
Sequence

41 - 

ccgcacuguggguacuugcug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).