Stem-loop sequence cpo-mir-106a

AccessionMI0038618 (change log)
DescriptionCavia porcellus miR-106a stem-loop
Stem-loop
   ---aa        a  g     g   c  u 
5'      aagugcuu ca ugcag uag uu u
        |||||||| || ||||| ||| || u
3'      uucacgaa gu acguc auc ag a
   cauuc        c  a     -   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2513060-2513118 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-106a
cpo-mir-106aDS562983.1: 2513060-2513118 [-]
cpo-mir-18bDS562983.1: 2512897-2512961 [-]
cpo-mir-20bDS562983.1: 2512676-2512744 [-]
cpo-mir-19b-2DS562983.1: 2512548-2512615 [-]
cpo-mir-92a-2DS562983.1: 2512411-2512471 [-]
cpo-mir-363DS562983.1: 2512251-2512315 [-]
Database links

Mature sequence cpo-miR-106a-5p

Accession MIMAT0046955
Sequence

1 - 

aaaagugcuuacagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-106a-3p

Accession MIMAT0046956
Sequence

37 - 

acugcaaugcaagcacuucuuac

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).