Stem-loop sequence cpo-mir-105

AccessionMI0038617 (change log)
DescriptionCavia porcellus miR-105 stem-loop
Stem-loop
   -u  a          uc        g ug 
5'   ca augcucagac  cuguggug c  c
     || ||||||||||  |||||||| |  u
3'   gu uacgaguuug  ggcaccac g  u
   uc  g          ua        - ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS563052.1: 745545-745603 [+]
intergenic
Database links

Mature sequence cpo-miR-105-5p

Accession MIMAT0046953
Sequence

1 - 

ucaaaugcucagacuccuguggug

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-105-3p

Accession MIMAT0046954
Sequence

37 - 

ccacggauguuugagcaugugcu

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).