Stem-loop sequence cpo-mir-103-1

AccessionMI0038615 (change log)
DescriptionCavia porcellus miR-103-1 stem-loop
Literature search

1 open access papers mention cpo-mir-103-1
(6 sentences)

Stem-loop
   ----    u  u           c   u g a 
5'     ggcu cu uacagugcugc uug u c u
       |||| || ||||||||||| ||| | |  
3'     ucgg ga auguuacgacg aac a g a
   agua    -  c           -   u g u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562872.1: 14743814-14743873 [-]
intergenic
Database links

Mature sequence cpo-miR-103-5p

Accession MIMAT0046950
Sequence

1 - 

ggcuucuuuacagugcugccuug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-103-3p

Accession MIMAT0046951
Sequence

38 - 

agcagcauuguacagggcuauga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).