Stem-loop sequence cpo-mir-101-2

AccessionMI0038614 (change log)
DescriptionCavia porcellus miR-101-2 stem-loop
Stem-loop
   --                c a    guaug 
5'   ucgguuaucaugguac g ugcu     u
     |||||||||||||||| | ||||      
3'   agucaauagugucaug c augg     c
   ga                a -    aaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562876.1: 15000495-15000553 [-]
intergenic
Database links

Mature sequence cpo-miR-101-2-5p

Accession MIMAT0046949
Sequence

1 - 

ucgguuaucaugguaccgaugcu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-101-3p

Accession MIMAT0046948
Sequence

38 - 

uacaguacugugauaacugaag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).