Stem-loop sequence cpo-mir-100

AccessionMI0038612 (change log)
DescriptionCavia porcellus miR-100 stem-loop
Stem-loop
   --a   c     uc   a      g  au 
5'    acc guaga  cga cuugug ug  u
      ||| |||||  ||| |||||| ||   
3'    ugg caucu  guu gaacac ac  g
   guc   a     gu   c      -  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562874.1: 26131486-26131542 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-100
cpo-mir-100DS562874.1: 26131486-26131542 [+]
cpo-let-7a-2DS562874.1: 26138016-26138082 [+]
Database links

Mature sequence cpo-miR-100-5p

Accession MIMAT0046945
Sequence

1 - 

aacccguagauccgaacuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-100-3p

Accession MIMAT0046946
Sequence

36 - 

caagcuugugucuacaggucug

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).