Stem-loop sequence cpo-mir-99b

AccessionMI0038611 (change log)
DescriptionCavia porcellus miR-99b stem-loop
Stem-loop
   --c         ac   c    c --g   c 
5'    acccguaga  cga cuug g   ggc u
      |||||||||  ||| |||| |   |||  
3'    ugggugucu  gcu gaac c   ccg u
   gcc         gu   c    a aca   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562925.1: 6340368-6340427 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-99b
cpo-mir-99bDS562925.1: 6340368-6340427 [-]
cpo-let-7eDS562925.1: 6340207-6340273 [-]
cpo-mir-125aDS562925.1: 6339828-6339887 [-]
Database links

Mature sequence cpo-miR-99b-5p

Accession MIMAT0046943
Sequence

1 - 

cacccguagaaccgaccuugcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-99b-3p

Accession MIMAT0046944
Sequence

39 - 

caagcucgugucuguggguccg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).