Stem-loop sequence cpo-mir-99a

AccessionMI0038610 (change log)
DescriptionCavia porcellus miR-99a stem-loop
Stem-loop
   --a         uc   u      g aaa 
5'    acccguaga  cga cuugug u   g
      |||||||||  ||| |||||| |   u
3'    uggguaucu  gcu gaacac g   g
   guc         uc   c      g cag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562889.1: 6525110-6525168 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-99a
cpo-mir-99aDS562889.1: 6525110-6525168 [-]
cpo-let-7cDS562889.1: 6524372-6524438 [-]
Database links

Mature sequence cpo-miR-99a-5p

Accession MIMAT0046941
Sequence

1 - 

aacccguagauccgaucuugug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-99a-3p

Accession MIMAT0046942
Sequence

38 - 

caagcucgcuucuaugggucug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).