Stem-loop sequence cpo-mir-96

AccessionMI0038608 (change log)
DescriptionCavia porcellus miR-96 stem-loop
Stem-loop
   --u        a      uu      - u  cu 
5'    uuggcacu gcacau  uugcuu g gu  c
      |||||||| ||||||  |||||| | ||   
3'    aaccguga cgugua  aacgag c cg  u
   uau        -      cu      u u  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562866.1: 50142184-50142247 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-96
cpo-mir-183DS562866.1: 50142394-50142455 [-]
cpo-mir-96DS562866.1: 50142184-50142247 [-]
cpo-mir-182DS562866.1: 50138735-50138799 [-]
Database links

Mature sequence cpo-miR-96-5p

Accession MIMAT0046937
Sequence

1 - 

uuuggcacuagcacauuuuugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-96-3p

Accession MIMAT0046938
Sequence

43 - 

caaucaugugcagugccaauau

 - 64

Get sequence
Evidence not experimental

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).