Stem-loop sequence cpo-mir-92b

AccessionMI0038605 (change log)
DescriptionCavia porcellus miR-92b stem-loop
Stem-loop
   -a   a       c            uucuu 
5'   ggg cgggacg ggugcaguguug     u
     ||| ||||||| ||||||||||||     c
3'   ucc gcccugc ucacguuauaac     c
   cc   g       -            caccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562865.1: 16106081-16106143 [+]
intergenic
Database links

Mature sequence cpo-miR-92b-5p

Accession MIMAT0046931
Sequence

1 - 

agggacgggacgcggugcaguguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-92b-3p

Accession MIMAT0046932
Sequence

42 - 

uauugcacucgucccggccucc

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).