Stem-loop sequence cpo-mir-92a-2

AccessionMI0038604 (change log)
DescriptionCavia porcellus miR-92a-2 stem-loop
Stem-loop
   --    g     uu  u   u     g   u 
5'   gggu gggau  gu gca uacuu uau a
     |||| |||||  || ||| ||||| ||| u
3'   uccg cccug  ca cgu augaa aug a
   ug    g     uu  -   u     -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562983.1: 2512411-2512471 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-92a-2
cpo-mir-106aDS562983.1: 2513060-2513118 [-]
cpo-mir-18bDS562983.1: 2512897-2512961 [-]
cpo-mir-20bDS562983.1: 2512676-2512744 [-]
cpo-mir-19b-2DS562983.1: 2512548-2512615 [-]
cpo-mir-92a-2DS562983.1: 2512411-2512471 [-]
cpo-mir-363DS562983.1: 2512251-2512315 [-]
Database links

Mature sequence cpo-miR-92a-2-5p

Accession MIMAT0046930
Sequence

1 - 

ggguggggauuuguugcauuacu

 - 23

Get sequence
Evidence not experimental

Mature sequence cpo-miR-92a-3p

Accession MIMAT0046929
Sequence

40 - 

uauugcacuugucccggccugu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).