Stem-loop sequence cpo-mir-34c

AccessionMI0038602 (change log)
DescriptionCavia porcellus miR-34c stem-loop
Stem-loop
   --a   a    a     c      c  a 
5'    ggc gugu guuag ugauug ua u
      ||| |||| ||||| |||||| ||  
3'    ccg caca caauc acuaac au a
   gga   g    c     -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562874.1: 36239332-36239386 [-]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-34c
cpo-mir-34bDS562874.1: 36239766-36239824 [-]
cpo-mir-34cDS562874.1: 36239332-36239386 [-]
Database links

Mature sequence cpo-miR-34c-5p

Accession MIMAT0046926
Sequence

1 - 

aggcaguguaguuagcugauugc

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-34c-3p

Accession MIMAT0046927
Sequence

34 - 

aaucacuaaccacacggccagg

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).