Stem-loop sequence cpo-mir-34a

AccessionMI0038600 (change log)
DescriptionCavia porcellus miR-34a stem-loop
Stem-loop
   --u        -   a          guga   u 
5'    ggcagugu cuu gcugguuguu    gua u
      |||||||| ||| ||||||||||    |||  
3'    ccgucaua gaa cgacuaacga    cgu g
   auc        u   -          agga   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562880.1: 24334354-24334419 [+]
intergenic
Database links

Mature sequence cpo-miR-34a-5p

Accession MIMAT0046922
Sequence

1 - 

uggcagugucuuagcugguugu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-34a-3p

Accession MIMAT0046923
Sequence

45 - 

aaucagcaaguauacugcccua

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).