Stem-loop sequence cpo-mir-33b

AccessionMI0038599 (change log)
DescriptionCavia porcellus miR-33b stem-loop
Stem-loop
   --g          uu         g   g 
5'    ugcauugcug  gcauugcau ugu u
      ||||||||||  ||||||||| ||| g
3'    acgugacggc  cgugacgug gcg a
   ccg          uc         g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562920.1: 1533833-1533891 [-]
intergenic
Database links

Mature sequence cpo-miR-33b-5p

Accession MIMAT0046920
Sequence

1 - 

gugcauugcuguugcauugca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-33b-3p

Accession MIMAT0046921
Sequence

39 - 

cagugccucggcagugcagcc

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).