Stem-loop sequence cpo-mir-33a

AccessionMI0038598 (change log)
DescriptionCavia porcellus miR-33a stem-loop
Stem-loop
   --         a uu          -uu u 
5'   gugcauugu g  gcauugcaug   c g
     ||||||||| |  ||||||||||   | g
3'   uacgugaca c  uguaacgugc   g c
   ac         c uu          cau a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562883.1: 25329249-25329308 [+]
intergenic
Database links

Mature sequence cpo-miR-33a-5p

Accession MIMAT0046918
Sequence

1 - 

gugcauuguaguugcauugca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-33a-3p

Accession MIMAT0046919
Sequence

40 - 

caauguuuccacagugcauca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).