Stem-loop sequence cpo-mir-30d

AccessionMI0038594 (change log)
DescriptionCavia porcellus miR-30d stem-loop
Stem-loop
   --u         ccc           --  aca 
5'    guaaacauc   gacuggaagcu  gu   a
      |||||||||   |||||||||||  ||    
3'    cguuuguag   cugacuuucga  cg   c
   cgu         --a           gu  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562906.1: 2020362-2020423 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-30d
cpo-mir-30dDS562906.1: 2020362-2020423 [+]
cpo-mir-30bDS562906.1: 2026508-2026567 [+]
Database links

Mature sequence cpo-miR-30d-5p

Accession MIMAT0046910
Sequence

1 - 

uguaaacauccccgacuggaagcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-30d-3p

Accession MIMAT0046911
Sequence

41 - 

cuuucagucagauguuugcugc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).