Stem-loop sequence cpo-mir-29c

AccessionMI0038589 (change log)
DescriptionCavia porcellus miR-29c stem-loop
Stem-loop
   --         ucc       ---     u 
5'   accgauuuc   ugguguu   cagag c
     |||||||||   |||||||   ||||| u
3'   uggcuaaag   accacga   guuuu g
   au         uuu       ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562867.1: 15329893-15329950 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-29c
cpo-mir-29b-2DS562867.1: 15329414-15329477 [+]
cpo-mir-29cDS562867.1: 15329893-15329950 [+]
Database links

Mature sequence cpo-miR-29c-5p

Accession MIMAT0046901
Sequence

1 - 

accgauuucuccugguguucaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-29c-3p

Accession MIMAT0046902
Sequence

37 - 

uagcaccauuugaaaucgguua

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).