Stem-loop sequence cpo-mir-29a

AccessionMI0038586 (change log)
DescriptionCavia porcellus miR-29a stem-loop
Stem-loop
   --         uuu       c    ucaa 
5'   acugauuuc   ugguguu agag    u
     |||||||||   ||||||| ||||    a
3'   uggcuaaag   accacga ucuu    u
   au         ucu       -    uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (cavPor3; GCA_000151735.1) Overlapping transcripts
DS562899.1: 12026143-12026202 [+]
intergenic
Clustered miRNAs
< 10kb from cpo-mir-29a
cpo-mir-29b-1DS562899.1: 12025789-12025852 [+]
cpo-mir-29aDS562899.1: 12026143-12026202 [+]
Database links

Mature sequence cpo-miR-29a-5p

Accession MIMAT0046896
Sequence

1 - 

acugauuucuuuugguguucaga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cpo-miR-29a-3p

Accession MIMAT0046897
Sequence

39 - 

uagcaccaucugaaaucgguua

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:26733575 "The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference" Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D Genome Biol Evol. 8:330-344(2016).